View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8091_low_14 (Length: 473)
Name: NF8091_low_14
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8091_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 18 - 281
Target Start/End: Original strand, 6945960 - 6946223
Alignment:
| Q |
18 |
tcctttgcattgtgaggtttggtgggtcaggtgatctgtggagtttaatcctttggtgaaatagttgattgttggtcaatcttctgggatgtagttcatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6945960 |
tcctttgcattgtgaggtttggtgggtcaggtgatctgtggagtttaatcctttggtgaaatagttgattgttggtcaatcttctgggatgtagttcatg |
6946059 |
T |
 |
| Q |
118 |
gtgccttttctctggcttgataggagttgtagagatgttacaattttggaaaggctcttggttggatctttggtgttggtgaagtataattctgaggtat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6946060 |
gtgccttttctctggcttgataggagttgtagagatgttacaattttgaaaaggctcttggttggatctttggtgttggtgaagtataattctgaggtat |
6946159 |
T |
 |
| Q |
218 |
gttaattgcattgttgagtcgtcttggttgtatctcaatatccttgtcatgttggctgcgaaat |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6946160 |
gttaattgcattgttgagtcgtcttggttgtatctcaatatccttatcatgttggctgcgaaat |
6946223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University