View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8091_low_29 (Length: 302)
Name: NF8091_low_29
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8091_low_29 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 16 - 302
Target Start/End: Original strand, 10561286 - 10561572
Alignment:
| Q |
16 |
caattagcttatgcatggatgaatattacctcaaaactttctattctaggtggcatgaaccctcttattcttgttgcataccgtcaaatctttggagctg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10561286 |
caattagcttatgcatggatgaatattacctcaaaactttctattttaggtggcatgaaccctcttatccttgttgcataccgtcaaatctttggagctg |
10561385 |
T |
|
| Q |
116 |
tttccattgctccctttgcttattggattgaacgtgataaagttccaaggatgacgaaacgcattatgattcagatattgttatcttccttaacaggagt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
10561386 |
tttccattgctccctttgcttattggattgaacgtgataaagttccaaggatgacaaaacgcattatggttcagatactgttatcttccttaacaggagt |
10561485 |
T |
|
| Q |
216 |
aacaggaagtcagattctatatttcataaggctaaaatattcaacccctataattgcatgtgcgctcaccaatttggacacagcttt |
302 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10561486 |
aacaggaagtcagattctgtatttcatagggctaaaatattcaaccccgataatcgcatgtgcgctcaccaatttggacacagcttt |
10561572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 45935808 - 45935860
Alignment:
| Q |
157 |
gttccaaggatgacgaaacgcattatgattcagatattgttatcttccttaac |
209 |
Q |
| |
|
|||||||||||||| || ||||||||| |||||||||||||||||||| |||| |
|
|
| T |
45935808 |
gttccaaggatgacaaagcgcattatggttcagatattgttatcttccataac |
45935860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University