View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8091_low_32 (Length: 296)
Name: NF8091_low_32
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8091_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 12 - 276
Target Start/End: Complemental strand, 37848644 - 37848399
Alignment:
| Q |
12 |
ggatttttattacgagcacgatatcgtgaagtctttaatcagtgattttatcttaaactgaggcccatggtggttgtaaaaaagnnnnnnnnnnnaaaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||||| | |
|
|
| T |
37848644 |
ggatttttattacgagcacgatatcgtgaagtctttaatcagtgattttatcttgaactgaggcccatgg-atttttaaaa------------------t |
37848564 |
T |
 |
| Q |
112 |
tgatttattacgagcatgattacattgaatgtttccgaaataacttacaaaaatcgaaaattaattgagggctttcgaagaagagatgataggaaacaat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37848563 |
tgatttattacgagcatgattacattgaatgtttccgaaataacttacaaaaatcaaaaattgattgagggctttcgaagaagagatgataagaaacaat |
37848464 |
T |
 |
| Q |
212 |
ttgatcggtttaattttggtagatgatgtctgtggcagccggaattcgaaagtgacgatggcgct |
276 |
Q |
| |
|
|||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37848463 |
ttgatcggttcaattttggaagatgaggtctgtggcagccggaattcgaaagtgacgatggcgct |
37848399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University