View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8091_low_36 (Length: 264)
Name: NF8091_low_36
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8091_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 249
Target Start/End: Original strand, 6997458 - 6997689
Alignment:
| Q |
19 |
gttcactaggtggatatctaacttgcctttgtaaatcagaatccctagatggaattaatatggttatataagcatgagatgttcgtttgtcaattcactc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
6997458 |
gttcactaggtggatatctaacttgcctttgtaaatcagaatccctagatggaattaatatggttatataagcatgagatgttcatttttcaattcactc |
6997557 |
T |
|
| Q |
119 |
ctttgctcagttatcacccaccatccctacccttggcacaaacactttaccaccgtcccttcccatttaatcggttgatcattgattcactcttttattt |
218 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6997558 |
ctttgctcagttatcaaccaccatccctacccttggcacaaacactttaccaccgtcccttcccatttaatcggttgatcattgattcactcctttattt |
6997657 |
T |
|
| Q |
219 |
tcacgaccctcca-aaatttgattatgaagtt |
249 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |
|
|
| T |
6997658 |
tcacgaccctccacaaatttgattatgaagtt |
6997689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 79
Target Start/End: Original strand, 7042596 - 7042656
Alignment:
| Q |
19 |
gttcactaggtggatatctaacttgcctttgtaaatcagaatccctagatggaattaatat |
79 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| | ||||||||| ||||| |
|
|
| T |
7042596 |
gttcactaggtggatatctaatttgcctttgtaaatcagaatctcaagatggaataaatat |
7042656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 7058664 - 7058704
Alignment:
| Q |
19 |
gttcactaggtggatatctaacttgcctttgtaaatcagaa |
59 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7058664 |
gttcactaggtggatatctaatttgcctttgtaaatcagaa |
7058704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 7022883 - 7022920
Alignment:
| Q |
19 |
gttcactaggtggatatctaacttgcctttgtaaatca |
56 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7022883 |
gttcactaggtggatatctaatttgcctttgtaaatca |
7022920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 53
Target Start/End: Original strand, 7006231 - 7006265
Alignment:
| Q |
19 |
gttcactaggtggatatctaacttgcctttgtaaa |
53 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7006231 |
gttcactaggtggatatctaatttgcctttgtaaa |
7006265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 7049749 - 7049786
Alignment:
| Q |
19 |
gttcactaggtggatatctaacttgcctttgtaaatca |
56 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
7049749 |
gttctctaggtggatatctaatttgcctttgtaaatca |
7049786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 125 - 214
Target Start/End: Original strand, 2933074 - 2933164
Alignment:
| Q |
125 |
tcagttatcacccaccatccctacccttggcacaaacactttacc-accgtcccttcccatttaatcggttgatcattgattcactctttt |
214 |
Q |
| |
|
|||||||||| |||||||||||||||| | |||||||||||||| ||| |||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
2933074 |
tcagttatcatccaccatccctaccctcgagacaaacactttacccaccatcccttcccactcaaccggttgatcattgattcactctttt |
2933164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 121 - 165
Target Start/End: Original strand, 17624082 - 17624126
Alignment:
| Q |
121 |
ttgctcagttatcacccaccatccctacccttggcacaaacactt |
165 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
17624082 |
ttgctcaattatcacccaccatccctaccattggcaataacactt |
17624126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University