View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8091_low_38 (Length: 256)

Name: NF8091_low_38
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8091_low_38
NF8091_low_38
[»] chr8 (2 HSPs)
chr8 (122-256)||(5172272-5172406)
chr8 (18-96)||(5172195-5172272)


Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 122 - 256
Target Start/End: Original strand, 5172272 - 5172406
Alignment:
122 aattaacattatgatgtgcaacccaaccttgacttcagaaacttacttctcaatgtgtgagcttggagttggatcaaatatgtgaaagagattagaaaaa 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5172272 aattaacattatgatgtgcaacccaaccttgacttcagaaacttacttctcaatgtgtgagcttggagttggatcaaatatgtgaaagagattagaaaaa 5172371  T
222 tagagtgactgtaaaaaatgtctcttgttgccttc 256  Q
    |||||||||||||||||||||||||||||||||||    
5172372 tagagtgactgtaaaaaatgtctcttgttgccttc 5172406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 18 - 96
Target Start/End: Original strand, 5172195 - 5172272
Alignment:
18 aatgccatgtttgaatatctctattatttnnnnnnngaaagaaggatggcagtttctctcacacataagttaattgcaa 96  Q
    |||||||||||||||||| ||||||||||       ||||| |||||||||||||||||||||| | ||||||||||||    
5172195 aatgccatgtttgaatatttctattatttaaaaaa-gaaagcaggatggcagtttctctcacacttgagttaattgcaa 5172272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University