View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8091_low_48 (Length: 242)
Name: NF8091_low_48
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8091_low_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 11 - 225
Target Start/End: Complemental strand, 33199622 - 33199406
Alignment:
| Q |
11 |
agtttggtgttcggtcatgttttaattatctttgtttcaaacaccactgtgtattctatgtttgatattacggtttgagnnnnnnnnnnnn-----gtta |
105 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |||| |
|
|
| T |
33199622 |
agtttgatgttcggtcatgttttaattatctttgtttcaaacaccactctgtattctatgtttgata---cggtttgagtttttttttttttttttgtta |
33199526 |
T |
|
| Q |
106 |
gtgcggtttgagtttgtttactctcttgcttaagtccctcaagtattgataaatgtcttgcctcaaataaatgaagacttaaattggttgatgctgatat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33199525 |
gtgcggtttgagtttgtttactctcttgctttagtccctcaagtattgataaatgtcttgcctcaaatatatgaagacttaaattggttgatgctgatat |
33199426 |
T |
|
| Q |
206 |
taatgaacaatgcaggtggt |
225 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
33199425 |
taatgaacaatgcaggtggt |
33199406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University