View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8091_low_55 (Length: 238)
Name: NF8091_low_55
Description: NF8091
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8091_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 14582568 - 14582790
Alignment:
| Q |
1 |
aaataattaagcatttttctccaaaggatcagaagcttttgttatagcatggcaaaccggcaagtcacaaaaaggcaatggattcctttttggagtctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14582568 |
aaataattaagcatttttctccaaaggatcagaagcttttgttatagcatggcaaaccggcaagtcacaaaaaggcaatggattcctttttggagtctta |
14582667 |
T |
 |
| Q |
101 |
atggctatgtatcaatcactctatctatgtagcactgacactttagattgaaggcgcgtcccgtgcctgtgtttgtgcttcgtagattgttatagttatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14582668 |
atggctatgtatcaatcactctatctatgtagcactgacactttagattgaaggcgcgtcccgtgcctgtgtttgtgcttcgtagattgttatagttatt |
14582767 |
T |
 |
| Q |
201 |
ttcttgcagtagaatgtaataat |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
14582768 |
ttcttgcagtagaatgtaataat |
14582790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 156
Target Start/End: Complemental strand, 37084194 - 37084164
Alignment:
| Q |
126 |
tatgtagcactgacactttagattgaaggcg |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37084194 |
tatgtagcactgacactttagattgaaggcg |
37084164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 123 - 155
Target Start/End: Original strand, 11818224 - 11818256
Alignment:
| Q |
123 |
atctatgtagcactgacactttagattgaaggc |
155 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
11818224 |
atctatgtagcactgacacttcagattgaaggc |
11818256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 125 - 153
Target Start/End: Complemental strand, 17519125 - 17519097
Alignment:
| Q |
125 |
ctatgtagcactgacactttagattgaag |
153 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17519125 |
ctatgtagcactgacactttagattgaag |
17519097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University