View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8092_high_22 (Length: 229)
Name: NF8092_high_22
Description: NF8092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8092_high_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 7 - 212
Target Start/End: Original strand, 384784 - 384989
Alignment:
| Q |
7 |
agtgagaagaagaagattaataggatgacgacaaagaggacatttgcaaggctgaagaggagaataatattgccaaacttggataatacagtttgcacaa |
106 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
384784 |
agtgggaagaagaagattaataggacgacgacaaagaggacatttgcaaggttgaagaggagaagaatattgccaaacttggataatacagtttgcacaa |
384883 |
T |
|
| Q |
107 |
aaccagtgagaacaatttgcttgacatgggagttggaagttttcgtgacagattgaacatccatcgttcgttgctggaccttcgccgctgctgtgatgct |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
384884 |
aaccagtgagaacaatttgcttgacatgggagttggaagttttcgtgacagattgaacatcgatcgttcgttgctggaccttcgccgctgctgtgatgct |
384983 |
T |
|
| Q |
207 |
ctacat |
212 |
Q |
| |
|
|||||| |
|
|
| T |
384984 |
ctacat |
384989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 16 - 195
Target Start/End: Original strand, 390173 - 390352
Alignment:
| Q |
16 |
aagaagattaataggatgacgacaaagaggacatttgcaaggctgaagaggagaataatattgccaaacttggataatacagtttgcacaaaaccagtga |
115 |
Q |
| |
|
|||||| ||||||||| ||||||| ||||||||||||||||| |||||||||||| |||| |||||||||||||| || ||||| || |||||||||||| |
|
|
| T |
390173 |
aagaaggttaataggacgacgacagagaggacatttgcaaggttgaagaggagaagaatactgccaaacttggattatgcagttagcgcaaaaccagtga |
390272 |
T |
|
| Q |
116 |
gaacaatttgcttgacatgggagttggaagttttcgtgacagattgaacatccatcgttcgttgctggaccttcgccgct |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |||| ||||||||| ||||| |
|
|
| T |
390273 |
gaacaatttgcttgacatgggagttggaagtttccgtgacagattgaacatagatcgtttgttggtggaccttctccgct |
390352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University