View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8092_low_15 (Length: 294)
Name: NF8092_low_15
Description: NF8092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8092_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 24 - 287
Target Start/End: Complemental strand, 44644922 - 44644660
Alignment:
| Q |
24 |
ggtgtctatctcttccatgtaatgtagatgtgggagaaatgagaagnnnnnnnntaaagatgatccagattgaaagttttgcatatgataatgagaattg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44644922 |
ggtgtctatctcttccatgtaatgtagatgtgggagaaatgaga-ggaaaaaaataaagatgatccagattgaaagttttgcatatgataatgagaattg |
44644824 |
T |
 |
| Q |
124 |
ctaaatatactacgaatgagtcaacacatgaaatttcaagaatatctgtcatgtttttaattagggctgattaaataaattatccttatgaatcttcaga |
223 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
44644823 |
ctaaatatagtacgaatgagtcaacacatgaaatttcaagaatatctgtcatgtttttaattagggctgattaaataatttatccttgtgaatcttcaga |
44644724 |
T |
 |
| Q |
224 |
aatttattaaattgcaaagatcttattattctccaatagagtttttgcgtgacaaggggatcta |
287 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
44644723 |
aatttattaaatcgcaaagatcttattattctccaatagaatttttgtgtgacaaggggatcta |
44644660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University