View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8092_low_19 (Length: 274)
Name: NF8092_low_19
Description: NF8092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8092_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 261
Target Start/End: Complemental strand, 33110781 - 33110534
Alignment:
| Q |
14 |
tgagatgaagagcggaagaagtaaggaccaagtttaacagagtggatatctgaaatggatgttcatgtgagaataacatcatcaacatataccaatagag |
113 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33110781 |
tgagatgaagagcgggagaagtaaggaccaagtttaacagagtggatatctgaaatggatgttcatgtgagaataacatcatcaacatataccaacagag |
33110682 |
T |
 |
| Q |
114 |
ttgtgaaagagtagaggnnnnnnnnagtgaacaatgaataatcagattgggattgagtgaatccaatagnnnnnnngaggataatttggagagccattgc |
213 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33110681 |
ttgtgaaagagtagaggttttttttagtgaacaatgaataatcagattgggattgagtgaatccaatagaaaaaaagaggataatttggagagccattgc |
33110582 |
T |
 |
| Q |
214 |
agcttgccttatttcaaaccataaagaggtttaaagtagtttacaaac |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33110581 |
agcttgccttatttcaaaccataaagaggtttaaagtagtttacaaac |
33110534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University