View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8092_low_21 (Length: 265)
Name: NF8092_low_21
Description: NF8092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8092_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 43 - 119
Target Start/End: Original strand, 54282574 - 54282650
Alignment:
| Q |
43 |
ctagctactcatctgtttgattcagtccaagaggacattattccatcgattcaaatctcatctgttaggtgactgga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54282574 |
ctagctactcatctgtttgattcagtccaagaggacattattccatcgattcaaatctcatctgttaggtgactgga |
54282650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 185 - 249
Target Start/End: Original strand, 54282652 - 54282716
Alignment:
| Q |
185 |
gtgtgccgacacgtgtcatgctagctcaaagacacatccaatgtctcttacattgtccttggtgc |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54282652 |
gtgtgccgacacgtgtcatgctagctcaaagacacatccaatgtctcttacattgtccttggtgc |
54282716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University