View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8092_low_22 (Length: 264)
Name: NF8092_low_22
Description: NF8092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8092_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 14 - 224
Target Start/End: Original strand, 9669504 - 9669710
Alignment:
| Q |
14 |
tcaaccaaaaggtaaagtgtaaccaaagattattctaccaaagagtgacgattcaattgtagataaaacttattaatctattccccaacttatcaaactc |
113 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9669504 |
tcaaccaaaaggtaacgtgtaac-aaagattattctaccaaagagtgacaatttaattgtagataaaacttattaatct---ccccaacttatcaaactc |
9669599 |
T |
 |
| Q |
114 |
nnnnnnngcaagatcaaacctcaaacctttgttgctaagtataagagtgataaaagcatggataaatatttcacgggtgccaatcaaatagaaaggacga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9669600 |
aaaaaaagcaagatcaaacctcaaacctttgttgctaggtttaagagtgataaaagcatggataaatatttcacgggtgccaatcaaatagaaaggacga |
9669699 |
T |
 |
| Q |
214 |
agtaaaaaaca |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
9669700 |
agtaaaaaaca |
9669710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University