View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8092_low_27 (Length: 236)
Name: NF8092_low_27
Description: NF8092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8092_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 68 - 188
Target Start/End: Complemental strand, 33404194 - 33404074
Alignment:
| Q |
68 |
agaatgagagtaatattannnnnnnccagcataaatgaaatttaattaacaataaagaagaggactacaagattctttacgatcagcgacaatcaaatta |
167 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33404194 |
agaatgagagtaatattatttttttccagtataaatgaaatttaattaacaataaagaagaggactacaagattctttacgatcagcgacaatcaaatta |
33404095 |
T |
 |
| Q |
168 |
tctaaactagaataggatgac |
188 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33404094 |
tctaaactagaataggatgac |
33404074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University