View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8092_low_29 (Length: 227)
Name: NF8092_low_29
Description: NF8092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8092_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 6e-92; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 175
Target Start/End: Original strand, 38448905 - 38449079
Alignment:
| Q |
1 |
ttcagaacttctctcaaaacaatgagagattcttctctgaagttagggacagtatctgctactaaaaggttgaacttgataggacctttggtgcagcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38448905 |
ttcagaacttctctcaaaacaatgagagattcttctctgaagttagggacagtatctgctactaaaaggttgaacttgataggacctttggtgcagcatt |
38449004 |
T |
|
| Q |
101 |
gttgcaatatcaagttgctcctattgctgaagttatattagaaaaattgatgaatcgagatgttgaggaagcatg |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38449005 |
gttgcaatatcaagttgctcctattgctgaagttatattagaaaaatggatgaatcgagatgttgaggaagcatg |
38449079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 52 - 175
Target Start/End: Original strand, 38440567 - 38440691
Alignment:
| Q |
52 |
gtatctgctactaaaaggttgaacttgataggacct-ttggtgcagcattgttgcaatatcaagttgctcctattgctgaagttatattagaaaaattga |
150 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38440567 |
gtatctgctgctacaaggttgaacttgataggaccccttggtgcagcattgttgcaacatcaagttgctcctattgctgaagttatattagaaaaatgga |
38440666 |
T |
|
| Q |
151 |
tgaatcgagatgttgaggaagcatg |
175 |
Q |
| |
|
||||||| ||||||||||||||||| |
|
|
| T |
38440667 |
tgaatcgtgatgttgaggaagcatg |
38440691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 8 - 57
Target Start/End: Original strand, 38440418 - 38440467
Alignment:
| Q |
8 |
cttctctcaaaacaatgagagattcttctctgaagttagggacagtatct |
57 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
38440418 |
cttctctcaaaacaatgagagattcttctatgaagttagggactgtatct |
38440467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 218
Target Start/End: Original strand, 38449112 - 38449148
Alignment:
| Q |
182 |
ttgccatggttacttgttttcaagactgttttcatct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38449112 |
ttgccatggttacttgttttcaagactgttttcatct |
38449148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 186 - 218
Target Start/End: Original strand, 38440729 - 38440761
Alignment:
| Q |
186 |
catggttacttgttttcaagactgttttcatct |
218 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
38440729 |
catggttacttgttttcaagattgttttcatct |
38440761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University