View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8092_low_6 (Length: 370)
Name: NF8092_low_6
Description: NF8092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8092_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 23 - 363
Target Start/End: Original strand, 33109848 - 33110188
Alignment:
| Q |
23 |
atgcattgctacccctcagcaaaatccagctagtgtacctgtcatttgatcatgatttttctcataccatgctttctgaaaacaatatatcttctcccgt |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33109848 |
atgcattgctacccctcagcaaaatccagctagtgtacctgtcatttgatcatgatttttctcataccatgctttctgaaaacaatatatcttctcccgt |
33109947 |
T |
 |
| Q |
123 |
gtcttctcaaactcgaagtgatctttctgataataataataatttgatttcgcaagtcacgaatcatgataacatttacaaatgtcagagaagtctgata |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33109948 |
gtcttctcaaactcgaagtgatctttctgataataataataatttgatttcgcaagtcacaaatcatgataacatttacaaatgtcagagaagtctgata |
33110047 |
T |
 |
| Q |
223 |
tcaaagtataaattaatagcaacattggcaagtcattgcctaaaccaaattttcaatcaggtaagtccattttatatcccttatcttcttttatgtccta |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33110048 |
tcaaagtataaattaatagcaacattggcaagtcattgcctaaaccaaattttcaatcaggtaagtccattttatatcccttatcttcttttatgtccta |
33110147 |
T |
 |
| Q |
323 |
tcactttttgtcttcttctcacaaacactttgtctctgcta |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33110148 |
tcactttttgtcttcttctcacaaacactttgtctttgcta |
33110188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University