View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8093_low_16 (Length: 241)
Name: NF8093_low_16
Description: NF8093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8093_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 2 - 223
Target Start/End: Complemental strand, 52734675 - 52734454
Alignment:
| Q |
2 |
ttgatagaatgaataatttaatcttctaaaccaatgaaagtaattaatgaatagaaactttaagaagaataaaactgaccaacagcttgccagcctctat |
101 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52734675 |
ttgataaaatgaataatttaatcttctaaaccaatgaaagtaattaatgaatagaaactttaagaagaataaaactgaccaacagcttgccagcctctat |
52734576 |
T |
 |
| Q |
102 |
agaagacacgatcgagctcaaggtggaagaaagagggatcaatataccatgatgatggaggtgtaacagctttctctataggaatatttggattgaactg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52734575 |
agaagacacgatcgagctcaaggtggaagaaagagggatcaatataccatgatgatggaggtgtaacagctttctctataggaatatttggattgaactg |
52734476 |
T |
 |
| Q |
202 |
ttgtgcaagtttctgagataca |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52734475 |
ttgtgcaagtttctgagataca |
52734454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University