View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8093_low_17 (Length: 240)
Name: NF8093_low_17
Description: NF8093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8093_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 5831909 - 5831770
Alignment:
| Q |
1 |
tttcactcctataatggaacttcttgactctagggtggtatcagttcattttagtccttctctacctcattggacttcagaacgacgtcgttgaagggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5831909 |
tttcactcctataatggaacttcttgactctagggtggtatcagttcattttagtccttctctacctcattggacttcagaacgacgtcgttgaagggtt |
5831810 |
T |
 |
| Q |
101 |
gtgtaataacgtgtatagtatgcagcatgcattgcacgag |
140 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||| ||||||| |
|
|
| T |
5831809 |
gtgtaataacgtgtttagcatgcagcatgcatagcacgag |
5831770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 141 - 201
Target Start/End: Original strand, 5824255 - 5824314
Alignment:
| Q |
141 |
atcatgcattgtcaatcttatggtgaaaaacttatttttcaagttctgttgagcttagatt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||| |
|
|
| T |
5824255 |
atcatgcattgtcaatcttatggtgaaaaac-taattttcaagttctgtttagcttagatt |
5824314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University