View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8094_high_12 (Length: 247)
Name: NF8094_high_12
Description: NF8094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8094_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 52 - 172
Target Start/End: Original strand, 33404074 - 33404194
Alignment:
| Q |
52 |
gtcatcctattctagtttagataatttgattgtcgctgatcgtaaagaatcttgtagtcctcttctttattgttaattaaatttcatttatgctggaaaa |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33404074 |
gtcatcctattctagtttagataatttgattgtcgctgatcgtaaagaatcttgtagtcctcttctttattgttaattaaatttcatttatactggaaaa |
33404173 |
T |
 |
| Q |
152 |
aaataatattactctcattct |
172 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
33404174 |
aaataatattactctcattct |
33404194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University