View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8094_low_10 (Length: 304)
Name: NF8094_low_10
Description: NF8094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8094_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 24 - 232
Target Start/End: Complemental strand, 41911757 - 41911571
Alignment:
| Q |
24 |
aattaacttatttttctgggtaaggagtcattgtacatcacaatcatacatagttaaggatttgctgccataagataagaccaatatccatggctggaac |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41911757 |
aattaacttatttttctgggtaaggagtcattgtacatcacaatcatacatagttaaggatttgctgccataagat-------------------ggaac |
41911677 |
T |
|
| Q |
124 |
caacagtttgtaatatgcataacagccaagtgccaaagacttctgcacagaaacctcttgaaagatgcgattcattttgtgtctccgtgaaatcaattaa |
223 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41911676 |
-aacagtttgtaat--gcataacagccaagtgccaaagacttctgcacagaaacctcttgaaagatgcgattcattttgtgtctccgtgaaatcaattaa |
41911580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University