View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8094_low_13 (Length: 247)

Name: NF8094_low_13
Description: NF8094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8094_low_13
NF8094_low_13
[»] chr8 (1 HSPs)
chr8 (52-172)||(33404074-33404194)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 52 - 172
Target Start/End: Original strand, 33404074 - 33404194
Alignment:
52 gtcatcctattctagtttagataatttgattgtcgctgatcgtaaagaatcttgtagtcctcttctttattgttaattaaatttcatttatgctggaaaa 151  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
33404074 gtcatcctattctagtttagataatttgattgtcgctgatcgtaaagaatcttgtagtcctcttctttattgttaattaaatttcatttatactggaaaa 33404173  T
152 aaataatattactctcattct 172  Q
    |||||||||||||||||||||    
33404174 aaataatattactctcattct 33404194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University