View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8094_low_14 (Length: 246)
Name: NF8094_low_14
Description: NF8094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8094_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 9669509 - 9669710
Alignment:
| Q |
1 |
caaaaggtaaagtgtaaccaaagattattctaccaaagagtgacgattcaattgtagataaaacttattaatctattccccaacttatcaaactcnnnnn |
100 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9669509 |
caaaaggtaacgtgtaac-aaagattattctaccaaagagtgacaatttaattgtagataaaacttattaatct---ccccaacttatcaaactcaaaaa |
9669604 |
T |
|
| Q |
101 |
nngcaagatcaaacctcaaacctttgttgctaagtataagagtgataaaagcatggataaatatttcacgggtgccaatcaaatagaaaggacgaagtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9669605 |
aagcaagatcaaacctcaaacctttgttgctaggtttaagagtgataaaagcatggataaatatttcacgggtgccaatcaaatagaaaggacgaagtaa |
9669704 |
T |
|
| Q |
201 |
aaaaca |
206 |
Q |
| |
|
|||||| |
|
|
| T |
9669705 |
aaaaca |
9669710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University