View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8095_high_6 (Length: 268)
Name: NF8095_high_6
Description: NF8095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8095_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 52 - 250
Target Start/End: Original strand, 2081042 - 2081238
Alignment:
| Q |
52 |
ttaaacttcaattactgcaatagtatgatatgacctttttgttgttattaaaaatttattgtcctattccttgttttgtattcgaactaggtggactcta |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2081042 |
ttaaacttcaattactgcaatagtatgatatgacctttttgttgttattaaaaatttattgtcctattccttgttttgtattcgaactaggtggactc-- |
2081139 |
T |
 |
| Q |
152 |
taagcttcatttgtatttcatcatgtgtgacttttcgtttgcttttagacataaagagtgtaggtggttatgagttgtggttgtcatgttaggtaatcg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2081140 |
taagcttcatttgtatttcatcatgtgtgacttttcgtttgcttttagatataaagagtgtgggtggttatgagttgtggttgtcatgttaggtaatcg |
2081238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University