View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8095_high_7 (Length: 262)
Name: NF8095_high_7
Description: NF8095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8095_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 29 - 251
Target Start/End: Complemental strand, 54424455 - 54424233
Alignment:
| Q |
29 |
gctagccactatgcagagtaaagtagcttctttattgctccaggaagcaacgttcaaaaatattttggctcgcagacggtgacacaaacagcaacttttt |
128 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
54424455 |
gctagccactatgcagaataaattagcttctttattgctccaggaagcaacgttcaaaaatattttggctcgcagacggggacacaaacaacaacttttt |
54424356 |
T |
 |
| Q |
129 |
tcatgcttcagcgttagccaggaaaagtaaaaatatggtaaagaagcttcgtgacaattctggtaattgggttacatcacatgaagacctctgcactctc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
54424355 |
tcatgcttcagcgttagccaggaaaagtaaaaatatggtaaagaagcttcgtgacaattctggtaattgggttacatcacatgaagacttctgcactctc |
54424256 |
T |
 |
| Q |
229 |
gttcataattacttcacctctct |
251 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
54424255 |
gttcataattacttcacctctct |
54424233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 72 - 249
Target Start/End: Original strand, 20120444 - 20120621
Alignment:
| Q |
72 |
gaagcaacgttcaaaaatattttggctcgcagacggtgacacaaacagcaacttttttcatgcttcagcgttagccaggaaaagtaaaaatatggtaaag |
171 |
Q |
| |
|
|||||| ||||| ||||| ||||||||||| | || ||||||||||||| ||||||||||||||||| | | |||||||| |||||||| ||||| |
|
|
| T |
20120444 |
gaagcagcgttcgaaaattttttggctcgcgaaaggggacacaaacagcagattttttcatgcttcagcatctgtcaggaaaaataaaaatacaataaag |
20120543 |
T |
 |
| Q |
172 |
aagcttcgtgacaattctggtaattgggttacatcacatgaagacctctgcactctcgttcataattacttcacctct |
249 |
Q |
| |
|
||||| ||||||| ||| | ||||||| |||| | ||||||||||| || |||| |||||||| |||||||||||| |
|
|
| T |
20120544 |
aagctacgtgacagttcagttaattggattacggcgcatgaagacctttgtgctcttgttcataactacttcacctct |
20120621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 137
Target Start/End: Original strand, 30168276 - 30168342
Alignment:
| Q |
71 |
ggaagcaacgttcaaaaatattttggctcgcagacggtgacacaaacagcaacttttttcatgcttc |
137 |
Q |
| |
|
||||||| |||||||||||||||||||| | || ||||||| ||||||||| || ||||| ||||| |
|
|
| T |
30168276 |
ggaagcagcgttcaaaaatattttggctatctgagggtgacataaacagcaagttctttcacgcttc |
30168342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University