View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8095_high_8 (Length: 250)
Name: NF8095_high_8
Description: NF8095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8095_high_8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 99 - 250
Target Start/End: Complemental strand, 36206800 - 36206645
Alignment:
| Q |
99 |
ttcaaactaaggttcaattgtaatgaattactatatata----gtgcaaatgcaatgggcaatgaaagatgcaaattcaagtctgatctaaaaattatta |
194 |
Q |
| |
|
||||||||||||| | || || ||||||||||||||||| |||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36206800 |
ttcaaactaaggtccgatcgtcatgaattactatatatatatagtgcaaatgcaatgggcaatcaaagatgcaaatttgagtctgatctaaaaattatta |
36206701 |
T |
 |
| Q |
195 |
ggaaataagttatagcgaattaagaagagaatagagatggcagaactttatgtgaa |
250 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36206700 |
ggaaattagttatagcgaattaagaagagaatagagatggcagaactttatgtgaa |
36206645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University