View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8095_low_10 (Length: 250)

Name: NF8095_low_10
Description: NF8095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8095_low_10
NF8095_low_10
[»] chr7 (1 HSPs)
chr7 (99-250)||(36206645-36206800)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 99 - 250
Target Start/End: Complemental strand, 36206800 - 36206645
Alignment:
99 ttcaaactaaggttcaattgtaatgaattactatatata----gtgcaaatgcaatgggcaatgaaagatgcaaattcaagtctgatctaaaaattatta 194  Q
    ||||||||||||| | || || |||||||||||||||||    |||||||||||||||||||| |||||||||||||  |||||||||||||||||||||    
36206800 ttcaaactaaggtccgatcgtcatgaattactatatatatatagtgcaaatgcaatgggcaatcaaagatgcaaatttgagtctgatctaaaaattatta 36206701  T
195 ggaaataagttatagcgaattaagaagagaatagagatggcagaactttatgtgaa 250  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
36206700 ggaaattagttatagcgaattaagaagagaatagagatggcagaactttatgtgaa 36206645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University