View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8096_low_11 (Length: 272)
Name: NF8096_low_11
Description: NF8096
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8096_low_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 60 - 145
Target Start/End: Original strand, 3573940 - 3574025
Alignment:
| Q |
60 |
tctgagattgtaatctttctttcgcagatcaatgttctagacaactatgtgagcaaacaactgcatgcaagacatgcatgtagagc |
145 |
Q |
| |
|
|||||| ||||| ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
3573940 |
tctgagtttgtattctttctctcgcagatcaatgttctagacaactatgtgagcaaacagctgcatgcaagacatgaatgcagagc |
3574025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 181 - 241
Target Start/End: Original strand, 3597083 - 3597143
Alignment:
| Q |
181 |
ctttgattagggttttcaagtcattgaataataacatgacacatttgcagcaatgtcctct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3597083 |
ctttgattagggttttcaagtcattgaataataacatgacacatttgcagcaatgtcctct |
3597143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University