View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8097_high_5 (Length: 288)
Name: NF8097_high_5
Description: NF8097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8097_high_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 162 - 273
Target Start/End: Original strand, 31263697 - 31263808
Alignment:
| Q |
162 |
ggtacttcattggagtggttattaaaattttgtagtgttcaaccgatattttcatataaccaacagcttgaagtagatgagcacaattgtacaagcaagt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| | |
|
|
| T |
31263697 |
ggtacttcattggagtggttattaaaattttgtagtgttcaaccgatattttcatataaccaacagcttgaagcagatgagcataattgtacaagcaaat |
31263796 |
T |
 |
| Q |
262 |
aatctatttctt |
273 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31263797 |
aatctatttctt |
31263808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 9 - 108
Target Start/End: Original strand, 31263544 - 31263643
Alignment:
| Q |
9 |
tttaatgtgttctgttatgtccaatgaaattcttcacnnnnnnnatttaatcctagtttctgagatttaatgttttgttatgtctagtggaaatcttcac |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31263544 |
tttaatgtgttctgttatgtccaatgaaattcttcactttttttatttaatcctagtttctgagatttaatgttttgttatgtctagtggaaatcttcac |
31263643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 233
Target Start/End: Complemental strand, 15853888 - 15853835
Alignment:
| Q |
180 |
ttattaaaattttgtagtgttcaaccgatattttcatataaccaacagcttgaa |
233 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| || |||| |||||||| |
|
|
| T |
15853888 |
ttattaaaattttgtagtgttcaacaaatattttcaattatccaatagcttgaa |
15853835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University