View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8097_low_12 (Length: 220)

Name: NF8097_low_12
Description: NF8097
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8097_low_12
NF8097_low_12
[»] chr2 (1 HSPs)
chr2 (33-202)||(41899453-41899623)


Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 33 - 202
Target Start/End: Original strand, 41899453 - 41899623
Alignment:
33 ttggattagattaaatttttatgggnnnnnnn-taattctattagttnnnnnnngtctttcgaatgagcagaatagacctaacaacagttccaatgtaca 131  Q
    |||||||||||||||||||||||||        ||||||||||||||       |||||||||||||||||||||||| |||||||||||||||| ||||    
41899453 ttggattagattaaatttttatgggaaaaaaaataattctattagttaaaaaaagtctttcgaatgagcagaatagacttaacaacagttccaatataca 41899552  T
132 atataatacgaagaatgtttagaacaaaacaaacttttgaattgagaatgaaacaaaatgatacaataggg 202  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41899553 atataatacgaagaatgtttagaacaaaacaaacttttgaattgagaatgaaacaaaatgatacaataggg 41899623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University