View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8099_low_20 (Length: 213)
Name: NF8099_low_20
Description: NF8099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8099_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 45621295 - 45621099
Alignment:
| Q |
1 |
aggactgaatgatattcatgtgtattgcaacttgagattaatttccttgttactgtgaccgtgtcttctagtgttgaaagagagattgggtttccctcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45621295 |
aggactgaatgatattcatgtgtattgcaacttgagattaatttccttgttactgtgaccgtgtcttctagtgttgaaagagagattgggtttccctcaa |
45621196 |
T |
|
| Q |
101 |
agcaaatccaagattgcagtgggaaaaatcatgtgatttttgtaaattggcagttgatgtggctatagaaaacaaaatggatggtggctgtgcataa |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45621195 |
agcaaatccaagattgcagtgggaaaaatcatgtgatttttgtaaattggcagttgatgtggctatagaaaacaaaatggatggtggctgtgcataa |
45621099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 21 - 80
Target Start/End: Complemental strand, 5117224 - 5117165
Alignment:
| Q |
21 |
tgtattgcaacttgagattaatttccttgttactgtgaccgtgtcttctagtgttgaaag |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||| ||||| ||||||| |
|
|
| T |
5117224 |
tgtattgcaacttgagattaatttccttgtttctgtgaccatgtctcctagttttgaaag |
5117165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 116 - 173
Target Start/End: Complemental strand, 5116823 - 5116766
Alignment:
| Q |
116 |
gcagtgggaaaaatcatgtgatttttgtaaattggcagttgatgtggctatagaaaac |
173 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
5116823 |
gcagtggaaaaaatcatgtgatttttgtaaacaggcagttgatgtggctccagaaaac |
5116766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University