View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8099_low_8 (Length: 325)
Name: NF8099_low_8
Description: NF8099
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8099_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 317
Target Start/End: Original strand, 36661227 - 36661525
Alignment:
| Q |
19 |
ccatctacataaccgaaacagacatgtgccaccttcctcctccatatcgatgaatgatcaaaatgaaagttctaacacgcggctgaaacgtgtggcataa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
36661227 |
ccatctacataaccgaaacagacatgtgccaccttcctcctccatgttgatgaatgatcaaaatgaaagttctaacacgcggctgaaacgtgtgggacag |
36661326 |
T |
 |
| Q |
119 |
tgggagatgtcgaaatttctttccgaaattcctagcatagtattaccgatgtcggttacgaattggtttgtgatgttgggctttatgggagaaccttcat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36661327 |
tgggagatgtcgaaatttctttccgaaattcctagcatagtattaccgacgtcggttacgaattggtttgtgatgttgggctttatgggagaaccttcat |
36661426 |
T |
 |
| Q |
219 |
gtttaacaccacataaagattgaatcaccaccaccaacaaggtttattcctgataaggttcattcttaacgccaaattggattgaaccaccaccaccaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36661427 |
gtttaacaccacataaagattgaatcactaccacccacaaggtttattcctgagaaggttcattcttaacgccaaattggattgaatcaccaccaccaa |
36661525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University