View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8100_high_14 (Length: 399)
Name: NF8100_high_14
Description: NF8100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8100_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 356; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 19 - 394
Target Start/End: Complemental strand, 38923580 - 38923205
Alignment:
| Q |
19 |
tcattacccttcaccggatgtccttaaccttctcaacttacctagatgctcctcatctttgctcacaaattcatcccccatttgcatgacaaacccaact |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38923580 |
tcattacccttcaccggatgtccttaaccttctcaacttacctagatgctcttcatctttgctcacaaattcatccaccatttgcatgacaaacccaact |
38923481 |
T |
 |
| Q |
119 |
caaaatccacccaattttcataattcaatgacttttcttggagaccttccaataggatcatcagacaacacaaacggatcatcggttttgtatgatcctc |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38923480 |
caaaatccacccaattttcataattcaatgacttttcttggagaccttccaataggatcatcagacaacacaagcggatcatcggttttgtatgatcctc |
38923381 |
T |
 |
| Q |
219 |
tatatcctttgaaccttcctccacagcctccagctctcagggaattgtttcaatctctgcctcgaggctatagcatgccaaccaactcgagaaatggttc |
318 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38923380 |
tatatcctttgaatcttcctccacagcctccagctctcagggaattgtttcaatctctgcctcgaggctatagcatgccaaccaactcgagaaatggttc |
38923281 |
T |
 |
| Q |
319 |
tcttttcggtggaggtgatgagatggagggagatggggatatgggagtgctggaattcaatagggtctctgcttct |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38923280 |
tcttttcggtggaggtgatgagatggagggagatggggatatgggagtgctggaattcaatagggtcactgcttct |
38923205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 71 - 392
Target Start/End: Complemental strand, 38909941 - 38909623
Alignment:
| Q |
71 |
tcatctttgctcacaaattcatcccccatttgcatgacaaacccaactcaaaatccacccaattttcataattcaatgacttttcttggagaccttccaa |
170 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||| ||||||||||||||||| ||||| ||||| ||| | ||||||| |||||||||||||||||||| |
|
|
| T |
38909941 |
tcatctttgctcacaaatccatccaccatttgcatcacaaacccaactcaaaagccacctaatttccattactcaatgagttttcttggagaccttccaa |
38909842 |
T |
 |
| Q |
171 |
taggatcatcagacaacacaaacggatcatcggttttgtatgatcctctatatcctttgaaccttcctccacagcctccagctctcagggaattgtttca |
270 |
Q |
| |
|
|||| ||| |||||| ||| |||||||| ||||| ||||||||||||| |||||||||||||||| ||||| |||| || || || |||||| ||| |
|
|
| T |
38909841 |
taggctca---gacaactcaagtggatcatcagttttatatgatcctctatttcctttgaaccttcctgcacagtctccggcccttagagaattgcctca |
38909745 |
T |
 |
| Q |
271 |
atctctgcctcgaggctatagcatgccaaccaactcgagaaatggttctcttttcggtggaggtgatgagatggagggagatggggatatgggagtgctg |
370 |
Q |
| |
|
|||||| ||||| | ||||||||||||||||||||| ||||||||||||| ||| |||||||| |||||||||||||||||||| | |||||||||| | |
|
|
| T |
38909744 |
atctctccctcgcgtctatagcatgccaaccaactcaagaaatggttctccttttggtggaggggatgagatggagggagatggaggtatgggagtgtcg |
38909645 |
T |
 |
| Q |
371 |
gaattcaatagggtctctgctt |
392 |
Q |
| |
|
||||||| | |||| |||||| |
|
|
| T |
38909644 |
caattcaacaaggtcactgctt |
38909623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 51; Significance: 4e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 167 - 273
Target Start/End: Original strand, 24802344 - 24802449
Alignment:
| Q |
167 |
ccaataggatcatcagacaacacaaacggatcatcggttttgtatgatcctctatatcctttgaaccttcctccacagcctccagctctcagggaattgt |
266 |
Q |
| |
|
||||||||| | ||| ||||||||| |||||||||| |||||||||||||||||| ||| |||||| ||| |||||| ||||||||||| |||||| || |
|
|
| T |
24802344 |
ccaataggagcttcatacaacacaagcggatcatcgtttttgtatgatcctctatttcc-ttgaactttcgtccacaacctccagctcttagggaaccgt |
24802442 |
T |
 |
| Q |
267 |
ttcaatc |
273 |
Q |
| |
|
||||||| |
|
|
| T |
24802443 |
ttcaatc |
24802449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University