View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8100_high_24 (Length: 347)
Name: NF8100_high_24
Description: NF8100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8100_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 307; Significance: 1e-173; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 13 - 335
Target Start/End: Original strand, 38440439 - 38440761
Alignment:
| Q |
13 |
attcttctctgaagttagggactgtatcttttcatcacgctcctatatttggactaacatgtggtgcgttagggttcgatagtacaagttctcagagagc |
112 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38440439 |
attcttctatgaagttagggactgtatcttttcatcacgctcctatatttggactaacatgtggtgcgttggggttcgatagtacaagttctcagagagc |
38440538 |
T |
|
| Q |
113 |
tttcatgttcataacaatgagagatgtggtatctgctgctacaaggttgaacttgataggaccccttggtgcagcattgttgcagcatcaagttgctcct |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38440539 |
tttcatgttcataacaatgagagatgtggtatctgctgctacaaggttgaacttgataggaccccttggtgcagcattgttgcaacatcaagttgctcct |
38440638 |
T |
|
| Q |
213 |
attgctgaaattatattagaaaaatggatgaatcgtgatgttgaggaagcatgtcaaactatgcctcttctagatactgtgcaaggttgtcatggttact |
312 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38440639 |
attgctgaagttatattagaaaaatggatgaatcgtgatgttgaggaagcatgtcaaactatgcctcttctagatactgtgcaaggttgtcatggttact |
38440738 |
T |
|
| Q |
313 |
tgttttcaagattgttttcatct |
335 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38440739 |
tgttttcaagattgttttcatct |
38440761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 141 - 335
Target Start/End: Original strand, 38448956 - 38449148
Alignment:
| Q |
141 |
gtatctgctgctacaaggttgaacttgataggaccccttggtgcagcattgttgcagcatcaagttgctcctattgctgaaattatattagaaaaatgga |
240 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38448956 |
gtatctgctactaaaaggttgaacttgataggacct-ttggtgcagcattgttgcaatatcaagttgctcctattgctgaagttatattagaaaaatgga |
38449054 |
T |
|
| Q |
241 |
tgaatcgtgatgttgaggaagcatgtcaaactatgcctcttctagatactgtgcaaggttgtcatggttacttgttttcaagattgttttcatct |
335 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
38449055 |
tgaatcgagatgttgaggaagcatgtcaaactatgcctcttctagacactgtgcaa-gttgccatggttacttgttttcaagactgttttcatct |
38449148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University