View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8100_high_36 (Length: 241)
Name: NF8100_high_36
Description: NF8100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8100_high_36 |
 |  |
|
| [»] scaffold0086 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0086 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 25627 - 25730
Alignment:
| Q |
1 |
acaatagaagtgatttatatttgtatgattttattttataagcatgtttggagtaaaaacttgattaaagtttttcaactcagtgcaaaactacttttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25627 |
acaatagaagtgatttatatttgtatgattttattt-ataagcatgtttggagtaaaaacttgatctaagtttttcaactcagtgcaaaactacttttat |
25725 |
T |
 |
| Q |
101 |
cactt |
105 |
Q |
| |
|
|||| |
|
|
| T |
25726 |
gactt |
25730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 121 - 225
Target Start/End: Original strand, 25696 - 25800
Alignment:
| Q |
121 |
tttttcaacttggtgcaaatactacttttatgacttttaaattgaccaatatttgaagacaaaacta-tatttttgtatggacataaactatttgacaaa |
219 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
25696 |
tttttcaactcagtgcaaa-actacttttatgacttttaaattgaccaatatttgaagacaaaactattttttttgtatggacattaactatttgacaaa |
25794 |
T |
 |
| Q |
220 |
aaatac |
225 |
Q |
| |
|
|||||| |
|
|
| T |
25795 |
aaatac |
25800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University