View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8100_low_21 (Length: 393)
Name: NF8100_low_21
Description: NF8100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8100_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 20 - 383
Target Start/End: Complemental strand, 31616576 - 31616213
Alignment:
| Q |
20 |
ttgtgatatgttgagggatgatggtataggttttcctgataatgccacgcttgtgactgttcttcctgcgtttgctgagaaagcggatattcatgcggga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31616576 |
ttgtgatatgttgagggatgatggtataggttttcctgataatgccacgcttgtgactgttcttcctgcgtttgctgagaaagcggatattcatgcggga |
31616477 |
T |
|
| Q |
120 |
tattggattcattgttatattgttaagacagggatgaaacttgatcctgctgttggttgtggtcttataactttgtactcgaattgtggctatataagaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31616476 |
tattggattcattgttatattgttaagacagggatgaaacttgatcctgctgttggttgtggtcttataactttgtactcgaattgtggctatataagaa |
31616377 |
T |
|
| Q |
220 |
tggcaaaagccgtttttgatcagataccggatagaaatgtcattgtgtggagtgcaattattaggtgctatgggatgcatggttttgctcaggaggcgct |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31616376 |
tggcaaaagccgtttttgatcagataccggatagaaatgtcattgtgtggagtgcaattattaggtgctatgggatgcatggttttgctcaggaggcgct |
31616277 |
T |
|
| Q |
320 |
cagtatgttccggcaattagttgagttgggcttgcatccagatggcattgtgtttttgtctctg |
383 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31616276 |
cagtatgttccggcaattagtcgagttgggcttgcatctagatggcattgtgtttttgtctctg |
31616213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University