View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8100_low_37 (Length: 283)
Name: NF8100_low_37
Description: NF8100
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8100_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 8e-98; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 46 - 267
Target Start/End: Complemental strand, 10355469 - 10355238
Alignment:
| Q |
46 |
acagaaagttggttggttatttagataatagaataatgccacatatcgtaatggtttgc----------tgctgtcaaaatcttttaaatgaataccagc |
135 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10355469 |
acagaaagttggttggttatttaggtaatggaataatgccacatctcgtaatggtttgcaatggtttgctgctgtcaaaatcttttaaatgaataccagc |
10355370 |
T |
 |
| Q |
136 |
tacaacatagatagaatccattggaatcaaaatattttccctgcactgtaaactagaactattttgatcttttaaatggttataaagtttctggcacgat |
235 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10355369 |
tacaacatagaaagaatccattggaatcaaaatattttccctgcactgtaaactagaactattttgatcttttaaatggttataaagtttctggcacgat |
10355270 |
T |
 |
| Q |
236 |
tattttttgaagtgaggtcttgatttagtgaa |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10355269 |
tattttttgaagtgaggtcttgatttagtgaa |
10355238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 140 - 201
Target Start/End: Complemental strand, 10350915 - 10350854
Alignment:
| Q |
140 |
acatagatagaatccattggaatcaaaatattttccctgcactgtaaactagaactattttg |
201 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
10350915 |
acatagaaagaatccattggaaacaaaatattttccctgcattgtaaactagaacaattttg |
10350854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 53 - 101
Target Start/End: Complemental strand, 10350997 - 10350949
Alignment:
| Q |
53 |
gttggttggttatttagataatagaataatgccacatatcgtaatggtt |
101 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||| |||||||||||| |
|
|
| T |
10350997 |
gttggttggttatttaggtaatggaataatgccacacatcgtaatggtt |
10350949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University