View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8101_low_13 (Length: 269)
Name: NF8101_low_13
Description: NF8101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8101_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 17 - 248
Target Start/End: Complemental strand, 32780213 - 32779979
Alignment:
| Q |
17 |
agtatgaattataatgtgaaatgttgctgctgatgctgcaagtgcgggatggagg---gagctgcaattttcagcgcagatattattgttactgttgtta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32780213 |
agtatgaattataatgtgaaatgttgctgctgatgctgcaagtgcgggatggaggagggagctgcaattttcagcgcagatattattgttactgttgtta |
32780114 |
T |
 |
| Q |
114 |
gagctttttgtgtttgtaatgataatgatggtttattcaactaaagatagattagccgtttttgtactttcacattttcaattttgttagttgtcacgcc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32780113 |
gagctttttgtgtttgtaatgataatgatggtttattcaactaaagatagattagccgtttttgtactttcacattttcaattttgttagttgtcacgcc |
32780014 |
T |
 |
| Q |
214 |
tatttcttgtgttttacttctacacgacgtgcgtc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32780013 |
tatttcttgtgttttacttctacacgacgtgcgtc |
32779979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University