View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8101_low_15 (Length: 261)
Name: NF8101_low_15
Description: NF8101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8101_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 26 - 242
Target Start/End: Original strand, 24340534 - 24340750
Alignment:
| Q |
26 |
tggtggtccatttagctaataatacatctcttttgccattgatcggtaacccttttatcggttgaaaaagaatggtagttacaagcccttactatcgaca |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24340534 |
tggtggtccatttagctaataatacatctcttttgccattgatcggtaacccttttatcggttgaaaaagaatggtagttacaagcccttactatcgaca |
24340633 |
T |
|
| Q |
126 |
agactttatgtctgggctgccttcaaatttatctagtcgcaactactcgaattttcacatcatgtagtcatgggaatttcaaattcatgtatttgaaaca |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24340634 |
agactttatgtctgggctgccttcaaatttatctagtcgcaactactcgaattttcatatcatgtagtcatgggaatttcaaattcatgtatttgaaaca |
24340733 |
T |
|
| Q |
226 |
tatgtgatatttcaatc |
242 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
24340734 |
tatgtgatatttcaatc |
24340750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University