View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8101_low_17 (Length: 257)
Name: NF8101_low_17
Description: NF8101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8101_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 38234200 - 38233974
Alignment:
| Q |
1 |
agtgatcaatattcagttagaagtacatatagattgtgtgttgaaatattgttgatatatctcatatgagacgacccacatgttggagtgcatatggtag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38234200 |
agtgatcaatattcagttagaagtacatatagattgtgtgttgaaatattgttgatatatctcatatgagacgacccacatgttggagtgcatatggtag |
38234101 |
T |
|
| Q |
101 |
cttaaggtacctccgaatgtgtgtaaatttgtgtggagagtttgtaggtannnnnnnncatactcgagcccgattaagtagcaggggtgtccaatactca |
200 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
38234100 |
cttaaggtacctctgaaagtgtgtaaatttgtgtggagagtttgtaggtattttttttcata---gggcccgattaagtagcaggggtgtccaatactca |
38234004 |
T |
|
| Q |
201 |
cttaactatgtcgtgtgcaatgctacttat |
230 |
Q |
| |
|
||||||||||||||||||||||| |||||| |
|
|
| T |
38234003 |
cttaactatgtcgtgtgcaatgcgacttat |
38233974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University