View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8101_low_18 (Length: 251)
Name: NF8101_low_18
Description: NF8101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8101_low_18 |
 |  |
|
| [»] scaffold0086 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0086 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 25567 - 25332
Alignment:
| Q |
1 |
ttattccgaccacccaagccgtcggtaatttcaaacttactaacggttacaggtcggtcgattataagtctaacttttgtggtggatatttcatcttaac |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||| |||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25567 |
ttattccgaccacccaagccgtcagtaatttcaaacttactaaaggtttcaggccagtcgattataagtctaacttttgtggtggatatttcatcttaac |
25468 |
T |
 |
| Q |
101 |
atttcttcgtcgtttcgaccccaaacatccatccatatcactaatcttcgtcatttgcactcacaccatcatttgcaattcacatggcctcgttgacaac |
200 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25467 |
atttctccgtcgtttcaaccccaaacatccat----atcactaatcttcgtcatttgcactcacaccgtcatttgcaattcacatggcctcgttgacaac |
25372 |
T |
 |
| Q |
201 |
gtgttatatccaactcgccactatttactacttttttcat |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25371 |
gtgttatatccaactcgccactatttactacttttttcat |
25332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University