View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8101_low_19 (Length: 244)
Name: NF8101_low_19
Description: NF8101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8101_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 19 - 228
Target Start/End: Original strand, 43476152 - 43476361
Alignment:
| Q |
19 |
tcaatctacggctggatgggattcaaaggcgcttatgcaaattgcagtgtatatcactttactcagtcatcatcacattcttgctagaggaagaagacgg |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43476152 |
tcaatctacggctggatggaattcaaaggcgcttatgcaaatagcagtgtagatcactttactcagtcatcatcacattcttgctagaggaaaaagacgg |
43476251 |
T |
|
| Q |
119 |
aggaggttgagacatctcatttggttggctgtaatttggtcattatggatcactaggaataagtcggtcttcgagagggggacatttggcataaatgagg |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
43476252 |
aagaggttgagacatctcatttggttggctgtaatttggtcattatggatcactaggaatgagtcggtctttgagagggggacatttggcataaatgagg |
43476351 |
T |
|
| Q |
219 |
gtgtaacaaa |
228 |
Q |
| |
|
|||||||||| |
|
|
| T |
43476352 |
gtgtaacaaa |
43476361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 14 - 228
Target Start/End: Complemental strand, 43564146 - 43563947
Alignment:
| Q |
14 |
ggacatcaatctacggctggatgggattcaaaggcgcttatgcaaattgcagtgtatatcactttactcagtcatcatcacattcttgctagaggaagaa |
113 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43564146 |
ggacttcaatctacggctggatgggattcaaaggcgcttatgcaaatagcagtgtagatcactttactcagtcatcatcacattcttgctagaggaagaa |
43564047 |
T |
|
| Q |
114 |
gacggaggaggttgagacatctcatttggttggctgtaatttggtcattatggatcactaggaataagtcggtcttcgagagggggacatttggcataaa |
213 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43564046 |
gacggaagaggttgagacatctcatt---------------tggtcattatggatcactaggaataagtcggtctttgagagggggacatttggcataaa |
43563962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University