View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8101_low_24 (Length: 239)
Name: NF8101_low_24
Description: NF8101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8101_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 21052536 - 21052319
Alignment:
| Q |
1 |
taattaaataaactaagagtagtacttaggcannnnnnn-attgatacaaaatactaaatttgtattatggcatcccactgcatctctaaccaccccttg |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
21052536 |
taattaaataaactaagagtagtacttaggcattttttttattgatacaaaatactaaatttgtattatggcatcccactacatcactaaccaccccttg |
21052437 |
T |
 |
| Q |
100 |
ttgagcatgtttagacccattctccttaattaactatttctaatggaaccggtgacatcacttttttaatcatttcttgacctattcaaaacacaattat |
199 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21052436 |
ttgagcatgtttagaccc------cttaattaactatttctaaaggaaccggtgacatcacttttttaatcatttcttgacctattcaaaacacaattat |
21052343 |
T |
 |
| Q |
200 |
taattactatctaatattttgatt |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
21052342 |
taattactatctaatattttgatt |
21052319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University