View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8101_low_25 (Length: 237)

Name: NF8101_low_25
Description: NF8101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8101_low_25
NF8101_low_25
[»] chr1 (1 HSPs)
chr1 (61-215)||(8248546-8248700)


Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 61 - 215
Target Start/End: Complemental strand, 8248700 - 8248546
Alignment:
61 cctctgcaactctctcgcacaccccttccagtcgccgtcctcgactccatccctctctgcaaacctgtcgacaaccacctgttctcatctttaagtcaga 160  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||    
8248700 cctctgcaactctctcgcacaccccttccggtcgccgtcctcgactccatccctctctgcaaacctgtcagcaaccacctgttctcatctttaagtcaga 8248601  T
161 tctctctcctctgcaaatccgttttggccggccactgtccaccatctgtagatct 215  Q
    ||||||||||||||||||||||||||| |||||| |||||||||||| |||||||    
8248600 tctctctcctctgcaaatccgttttggtcggccattgtccaccatctatagatct 8248546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University