View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8101_low_25 (Length: 237)
Name: NF8101_low_25
Description: NF8101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8101_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 61 - 215
Target Start/End: Complemental strand, 8248700 - 8248546
Alignment:
| Q |
61 |
cctctgcaactctctcgcacaccccttccagtcgccgtcctcgactccatccctctctgcaaacctgtcgacaaccacctgttctcatctttaagtcaga |
160 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8248700 |
cctctgcaactctctcgcacaccccttccggtcgccgtcctcgactccatccctctctgcaaacctgtcagcaaccacctgttctcatctttaagtcaga |
8248601 |
T |
 |
| Q |
161 |
tctctctcctctgcaaatccgttttggccggccactgtccaccatctgtagatct |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||||||||| ||||||| |
|
|
| T |
8248600 |
tctctctcctctgcaaatccgttttggtcggccattgtccaccatctatagatct |
8248546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University