View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8101_low_27 (Length: 229)
Name: NF8101_low_27
Description: NF8101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8101_low_27 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 160
Target Start/End: Original strand, 41555831 - 41555992
Alignment:
| Q |
1 |
ccaatcattgatttctctctgctcacttcagatgaccctcaaatccacacaaaagctgttcatgaactagccaaggcatgttctgaatggggtttcttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41555831 |
ccaatcattgatttctctctgctcacttcagatgaccctcaaatccacacaaaagctgttcatgaactagccaaggcatgttctgaatggggtttcttca |
41555930 |
T |
|
| Q |
101 |
tggtaacttttcctttctacc--tagtagttttctcaaatgatgcatgaaatttaatgtcaa |
160 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41555931 |
tggtaacttttcctttctacctatagtagttttctcaaatgatacatgaaatttaatgtcaa |
41555992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 5 - 119
Target Start/End: Original strand, 41560487 - 41560602
Alignment:
| Q |
5 |
tcattgatttctctctgctcacttcagatgaccctcaaatccacacaaaagctgttcatgaactagccaaggcatgttctgaatggggtttcttcatggt |
104 |
Q |
| |
|
|||||||||||||||| || || |||||||||| ||||||||||||| |||||||||||| | ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41560487 |
tcattgatttctctctcctaacctcagatgacctcaaaatccacacaaaggctgttcatgaaatcgccaaagcatgttctgaatggggtttcttcatggt |
41560586 |
T |
|
| Q |
105 |
aac-ttttcctttcta |
119 |
Q |
| |
|
||| |||||||||||| |
|
|
| T |
41560587 |
aactttttcctttcta |
41560602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University