View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8101_low_4 (Length: 443)
Name: NF8101_low_4
Description: NF8101
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8101_low_4 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 202 - 443
Target Start/End: Complemental strand, 9499596 - 9499355
Alignment:
| Q |
202 |
accaaatacggtaaatctaaacacagctgtttcacttagaattatttgcagtctgttgggtctgaacagttccaacaccggattttgctgcttttaaccc |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
9499596 |
accaaatacggtaaatctaaacacagctgtttcacttagaattatttgcagtctgttgggtctgaacagttccaacgctggattttgctgcttttaaccc |
9499497 |
T |
|
| Q |
302 |
aatttcttatggggataaaatcaccataaaacaatggttttgtgatggtctaatccaatttctcaggatatgtttactaaaaagtaggggagcatgcggc |
401 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
9499496 |
aatttcttatggggataaaatcaccataaaacaatggttttgtgatggtctaatccaatttctaaagatatgtttactaaaaagtaggggagcatgcggc |
9499397 |
T |
|
| Q |
402 |
tgaattataagaaaacatcatccaacttaaaatcatgcaatg |
443 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9499396 |
tgaattataagaaaacatcatccaacttaaaatcatgcaatg |
9499355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 15 - 168
Target Start/End: Complemental strand, 9499747 - 9499594
Alignment:
| Q |
15 |
ggacatcataggtgggtcatgcagaagtggggaagtaattccccattttacatgcctgatgaaataacggtcacgcatcactccttggatgtgttgggca |
114 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| || |
|
|
| T |
9499747 |
ggacaccataggtgggtcatgcagaaatggggaagtaattccccattttacatgcctgatgaaataacggtcacgcaccactccttggatgcattggaca |
9499648 |
T |
|
| Q |
115 |
gcggctacatttagctacccaaaatcggtgcaaccaactaccgtggcagagacc |
168 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9499647 |
gcggctacatttagctacccaaaatcagtgcaaccaactaccgtggcagagacc |
9499594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University