View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8102_high_15 (Length: 296)
Name: NF8102_high_15
Description: NF8102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8102_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 17 - 279
Target Start/End: Original strand, 52424148 - 52424410
Alignment:
| Q |
17 |
aacaaacttaagtggaaccctgctaggcacaagcaaatccaatgtttttaagttaaggctgtagttacgctgcaggcttttataaagtagnnnnnnnnnn |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52424148 |
aacaaacttaagtggaaccctgctaggcacaagcaaatccaatgtttttaagttaaggctgtagttacgctgcaggcttttataaagtagaaaaatgcaa |
52424247 |
T |
|
| Q |
117 |
nnnnnnnnntgtttttgctgtcaaaattgagattgggatgctgttgtggaaacctcaaaatccgttatattgcaattggagatcacaattcaaaacacct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52424248 |
aataaaaaatgtttttgctgtcaaaattgagattgggatgctgttgtggaaacctcaaaatccgttatattgcaattggagatcacaattcaaaacacct |
52424347 |
T |
|
| Q |
217 |
tgagaaaagcaaattcgcaaagagtaactaaccaacatgattggccactttcaccacaacctt |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52424348 |
tgagaaaagcaaattcgcaaagagtaactaaccaacatgattggccactttcaccacaacctt |
52424410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University