View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8102_low_14 (Length: 381)
Name: NF8102_low_14
Description: NF8102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8102_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 68 - 274
Target Start/End: Complemental strand, 3652985 - 3652773
Alignment:
| Q |
68 |
gtacagtctacattttttatcctcccaattttatatcgactggttaacaacatcatagtgatttgacatgtaatagttagtacttgttttgttaattttt |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3652985 |
gtacagtctacattttttatcctcccaattttatatcgactggttaagaacatcatagtgatttgacatgtaatagttagtacttgttttgttaattttt |
3652886 |
T |
 |
| Q |
168 |
agtcatgtttgtgtttttgtc------aacnnnnnnnntagtaagttgtgtcgatgttcttttctgtctagctttggtatgctttaaggtctatatttaa |
261 |
Q |
| |
|
|||| |||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3652885 |
agtcgtgtttgtgtttttgtcaaaaaaaaaaaaaaaaatagtaagttgtgtcgatgttcttttctgtctagctttggtatgctttaaggtctatatttaa |
3652786 |
T |
 |
| Q |
262 |
aagttgggttgaa |
274 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
3652785 |
aagtttggttgaa |
3652773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University