View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8102_low_20 (Length: 281)
Name: NF8102_low_20
Description: NF8102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8102_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 1 - 264
Target Start/End: Original strand, 26182766 - 26183032
Alignment:
| Q |
1 |
cttcctcttcattttcattct---tcacacttgtcccattttggagactgagaaaatctttttcatcttcttgcatgatcatcaccttttcgaggtttaa |
97 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
26182766 |
cttcctcttcattttcattcttcttcacacttatcccattttggagacttagaaaatctttttcatctttttgcatgatcatcgccttttcgaggtttaa |
26182865 |
T |
 |
| Q |
98 |
atccattgaacctttgcttggtggtggtgcagtcttggatttgcttcttgcacctcccttttcatgatcttctggctttcctgtgagtctttgaacaagc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26182866 |
atccattgaacctttgcttggtggtggtgcagtcttggatttgcttcttgcacctcccctttcatgctcttctggctttcctgtgagtctttgaacaagc |
26182965 |
T |
 |
| Q |
198 |
tctctgaaatttgcagcatcagtttttatgatttctggagcatatatgtgaattattcgggtctttg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
26182966 |
tctctgaaatttgcagcatcagtttttatgatttctggagcatatatatgaattattcggatctttg |
26183032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University