View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8102_low_21 (Length: 265)
Name: NF8102_low_21
Description: NF8102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8102_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 254
Target Start/End: Complemental strand, 1383393 - 1383159
Alignment:
| Q |
18 |
acctaacccctttctttgctcttgtgctccattccacaaggtacttatttccgatcataatcattcatcatatttaacgtaactaaccnnnnnnnnnctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1383393 |
acctaacccctttctttgctcttgtgctccattccacaaggtacttatttccgatcataatcattcatcatatttaacgtaactaacctttttttt--tt |
1383296 |
T |
|
| Q |
118 |
cttaaactaggagacttgcctttcacactgctgacgactttcgaaagctaggctctcagtttggtgtcaagtgtactatcgtaagctataatagaaaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
1383295 |
cttaaactaggagacttgcctttcacactgctgacgactttcgaaacctaggctctcagtttggtgtcaagtgtgctatcgtaagttataatagaaaatt |
1383196 |
T |
|
| Q |
218 |
gcataattcaatgtaatttaattacaagcgtgtgtgc |
254 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
1383195 |
gcataattcaatgtaatgtaattacaagtgtgtgtgc |
1383159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University