View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8102_low_24 (Length: 251)
Name: NF8102_low_24
Description: NF8102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8102_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 51 - 242
Target Start/End: Complemental strand, 43397072 - 43396881
Alignment:
| Q |
51 |
ctagagtaaagacacaatttagtctctcacaattttatcacggtctaatttaatccattacttnnnnnnncattaaagtagtccttgatattttcaaact |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43397072 |
ctagagtaaagacacaatttagtctctcacaattttatcacggcctagtttaatccattacttaaaaaaacattaaagtagtccttgatattttcaaact |
43396973 |
T |
 |
| Q |
151 |
ggagacaaattagtcctgaactcattataacagaggatttatttatcttcaatttgaaaatgtcaatgactagtttggtattatttcttctc |
242 |
Q |
| |
|
|| || ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43396972 |
ggggataaattagtcctgaactcattatacaagaggacttatttatcttcaatttgaaaatgtcaatgactagtttggtattatttcttctc |
43396881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 171 - 236
Target Start/End: Complemental strand, 32358605 - 32358539
Alignment:
| Q |
171 |
ctcattataacagagg-atttatttatcttcaatttgaaaatgtcaatgactagtttggtattattt |
236 |
Q |
| |
|
|||||||||||||||| | |||||| || ||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
32358605 |
ctcattataacagagggacttatttgtccccaatttgaaaatgtcaagggctagtttggtattattt |
32358539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 105
Target Start/End: Complemental strand, 38713375 - 38713335
Alignment:
| Q |
65 |
caatttagtctctcacaattttatcacggtctaatttaatc |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||| |||| |
|
|
| T |
38713375 |
caatttaatctctcacaattttatcacggtccaattcaatc |
38713335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University