View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8102_low_28 (Length: 237)
Name: NF8102_low_28
Description: NF8102
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8102_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 220
Target Start/End: Original strand, 37937899 - 37938103
Alignment:
| Q |
16 |
agaagaatccaaaaagatggaaattgatctctctttgaagatagatagtgatgatgagcaagaagaagaagtagatcgtgagcttgttaaagaggatgat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37937899 |
agaagaatccaaaaagatggaaattgatctctctttgaagatagatagtgatgatgagcaagaagaagaagtagatcgtgagcttgttaaagaggatgat |
37937998 |
T |
|
| Q |
116 |
gagaaggaagaagtacatgaagctacagctggtgaaatagaagatgatgatgcttcagttatacaactatctttgcaagatgacacgaaaataaaacagg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37937999 |
gagaaggaagaagtacatgaagctacagctggtgaaatagaagatgatgatgcttcagttatacaactatctttgcaagatgacacgaaaataaaacagg |
37938098 |
T |
|
| Q |
216 |
tatat |
220 |
Q |
| |
|
||||| |
|
|
| T |
37938099 |
tatat |
37938103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University